Mexico Not Taking It Lying Down!

[velvetmagnetta]

A couple of months ago, several of us on Lymenet Europe were having a spirited discussion about the merits of the Sapi Culture test. One of many topics brought up in that discussion was that of an analysis by Mexican scientists of the incidence of Lyme disease (several different strains) found on animals in the environment around the Texas-Mexico border.

Serious allegations of contamination were made by Barbara Johnson of the CDC regarding the Sapi culture test results suggesting that Sapi's results were merely artifacts of laboratory contamination - it just couldn't possibly be that Eva Sapi was able to grow spirochetes from infected patient blood samples even though (as was thoroughly discussed in that thread) growing Borrelia using BSK medium was nothing new or revolutionary. Even still, several opinion letters were published by the CDC affiliated scientist, Johnson, suggesting Sapi's culture results were false, her laboratory technique was sloppy, and/or the results were just simply made up.

It has since been found that Johnson's accusations of contamination in the Sapi culture were unfounded.

So, I guess it should come as no surprise that as soon as another group of scientists - this time epidemiologists - published results that the American IDSA-affiliated scientist, Alan Barbour, either didn't like, didn't believe, or was simply surprised about - another opinion letter writing spree ensued with, guess what, another damaging accusation of contamination!

But this time, the accused epidemiologists fought back. That's right. You can't bully Mexican scientists out of publishing results - and defending and standing by them - that you just don't like.

Here is the original Sapi culture thread:

Rebuttal published to CDC vs Advanced in J Clin Microbiology
http://www.lymeneteurope.org/forum/view ... f=5&t=5589


Page 3 in that same topic is where the Mexican scientific paper was fist brought up by Pandora:
http://www.lymeneteurope.org/forum/view ... 9&start=20


Here is the original paper published about the incidence of Lyme on the Mexico-Texas border:

Implications of climate change on the distribution of the tick vector Ixodes scapularis and risk for Lyme disease in the Texas-Mexico transboundary region
http://www.parasitesandvectors.com/content/7/1/199 *

*Oops! I messed up the links. The link above is the right one now


The original opinion letter of allegations of contamination in the Mexican paper alleged by Barbour:

Analysis of the intergenic sequences provided by Feria-Arroyo et al. does not support the claim of high Borrelia burgdorferi tick infection rates in Texas and northeastern Mexico
http://www.parasitesandvectors.com/content/7/1/467


And the decidedly thorough response, point-by-point, to every false accusation wielded at the group of epidemiologists:

Prevalence of Borrelia burgdorferi-infected ticks from wildlife hosts, a response to Norris et al.
http://www.parasitesandvectors.com/cont ... 9/abstract



Please note the difference between active and passive collection of ticks as described in the fourth paragraph in the "Discussion" section of the original paper:

Although our species distribution model is congruent with the spatial distribution of LD cases in humans for Texas (see maps in http://www.cdc.gov/lyme/stats/index.html webcite), a direct correlation cannot be established because additional vector density and B. burgdorferi prevalence data need to be gathered, and human movement has epidemiological consequences since infection can be acquired in a region different from the one where it is reported [27]. The density of infected I. scapularis nymphs (DIN) has been suggested as a strong predictor for LD risk of infection [56,57,82,89,101]. For Texas this risk of infection has been deemed low because no I. scapularis nymphs were detected using standardized sampling techniques over nine localities in the state [56,82,106]. This contrasts with the continuous reports of human LD cases and the detection of canine LD in the state [107-109]. As an initial approach to understand where infected I. scapularis ticks occurred in Texas and Mexico, we performed a combination of passive and active searches of different developmental stages of this competent LD vector. In our search we did find B. burgdorferi infected adult I. scapularis ticks in areas were human LD has been reported [8] and where canine LD has been observed [108]. The prevalence of I. scapularis infected with B. burgdorferi detected was higher than the 1% recorded in the early 1990’s using classical culture and microscopy techniques for the detection of B. burgdorferi[52,54,55], and than that observed more recently through a passive surveillance study and molecular techniques [13]. The adult ticks found in this preliminary study were either questing on vegetation or feeding on wildlife (WTD and gemsbok) and companion animals (mainly dogs). Therefore, our results suggest that infected I. scapularis nymphs are present in Texas, but sampling methods standardized for the conditions in Northeast and Midwest US sites might not be optimal to sample a representative I. scapularis nymph population questing in the Texas-Mexico transboundary region. Variation in environmental conditions influencing questing behavior may significantly impact the type of host ticks encounter and may lead to differential host use within a particular study area [110-113]. Therefore, further studies testing different sampling procedures, including different times of the day and seasons are currently being developed by our team. Our goal is to determine the phenology of I. scapularis in the Southern US and Mexico and the questing behavior of the different developmental stages to determine how that will affect the risk for LD in humans and companion animals.

(Everything in bold is my emphasis)

I swear, do these CDC and IDSA scientists even read the papers they're critiquing?

[hv808ct]

Mexico Not Taking It Lying Down!
Post by velvetmagnetta » Mon 2 Mar 2015 7:53

It has since been found that Johnson's accusations of contamination in the Sapi culture were unfounded.

Really, what journal did that appear in and by whom?

But this time, the accused epidemiologists fought back. That's right. You can't bully Mexican scientists out of publishing results - and defending and standing by them - that you just don't like.

Mexican scientists? Except for one of them, they all seem to be American scientists with one of them working for the federal USDA.

Department of Veterinary Pathobiology, College of Veterinary Medicine and
Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA

Department of Biology, The University of Texas-Pan American, Edinburg, TX
78539, USA

Department of Biology, College of Science and Engineering, Texas State
University, San Marcos, TX 78666, USA

Department of Entomology, College of Agriculture and Life Sciences, Texas
A&M University, College Station, TX 77843, USA

Unidad de Investigación en Enfermedades Infecciosas, Centro Médico Nacional
SXXI, IMSS, Distrito Federal 06720, México

USDA-ARS Knipling-Bushland U.S. Livestock Insects Research Laboratory,
Kerrville, TX 78028, USA


So what’s the big issue here? It might be as big as a difference of one amino acid. Otherwise, there also are these points:

The Feria-Arroyo et al. report does not include any ticks recovered from humans. It is highly possible that infection levels on non-human hosts differ from infection levels detected in humans, thus making both datasets not comparable.

Norris et al. stated in their letter that due to the low variability observed in the IGS from the
Texas samples most, if not all of them, were likely to have been originated from the same clone which they assume could be the product of contamination with the B31 strain. We disagree with the interpretation put forward by Norris et al. and instead think it is more likely that the lack of variability reported in Feria-Arroyo et al. reflects the level of B. burgdorferi variability present in the Texas-Mexico transboundary region.

The lack of variation in the IGS and flaB B. burgdorferi sequences may reflect the fact that low genetic variation of B. burgdorferi is present on ticks feeding on non-human hosts in the Texas-Mexico transboundary region sampled areas. It is not uncommon for bacteria to show different levels of genetic variation at different geographic locations.

Our team supports the fact that Texas is a low incidence state for human cases of LD; however, the ecology of this disease in the Texas-Mexico transboundary region is understudied.

And the kicker:

Norris et al. suggest that the Feria-Arroyo et al. publication is advocating a high LD risk in Texas and Mexico but this cannot be further from the truth. Unlike publications that have aimed to create disease risk maps based on questing infected nymphs the Feria-Arroyo et al. presents a habitat suitability model for the presence of the vector in the studied area, and no predictions are made in regards to the density and prevalence of infected ticks. We agree with Norris et al. that it is unfortunate that the “Feria-Arroyo et al. has been publicised as an indication of a significant Lyme disease risk in Texas” but misinterpretations of that paper in media outlets are not the responsibility of the authors.


Time and another PCR set will tell.

[duncan]

Silliness. TBD's are a growing risk in most if not all of the contiguous states in the U.S.. And North of the United States. South of it, too. East and west, as well. Europe, Asia, Australia, South America, etc - even Antarctica, or close to it. Daily, it seems, more and more scientific leaders - as well as political stalwarts - embrace and acknowledge this fact.

Denialists, on the other hand, are a dwindling breed. Cultural evolution is slowly but undeniably weeding out the weaker, um, "science" position, as it were.

[LHCTom]

I'm not a conspiracy theory type but I find this very odd and a bit sad.

First Barbara Johnson writes a paper that finds contamination in the Sapi culture and she is correct about the B garini but fails to investigate the source and fails to even discuss the other evidence and other sequences which showed a complete lack of scientific integrity and thoroughness. She intentionally found one problem (correctly) but used it to spin an opinion. Ok, she was leaving the CDC and had years of being hassled by Lyme people so ignored integrity and just wrote an incomplete analysis that left the reader with an incorrect conclusion.

What she did is decsribed here: https://puurelyrandom.wordpress.com/201 ... ssessment/

But now we have some top players Norris, Barbour and Fish playing a similar game of quationable integrity with a one sided incomplete analysis. Presumably to assert their authority and control improperly - it appears...

In the Sapi paper, I checked the Johnson claims of B garini contamination using the accession numbers listed and it was clear there was a group of samples contaminated by the test sample of garinii. But that is where the accuracy of her paper stopped. Then she spun a yarn that was not honest.

So I decided to see if these heavy hitters were correct given the researchers being accused of contamination were not the arch enemy Sapi. They did the same kind of thing when they saw a paper that suggested different tick infection rates in Texas/Mexico that were different than previous studies and implied the risk of Lyme in that geographic area might be much higher than previously thought.

Here in their "Letter to the Editor" "Analysis" piece, the tone and completeness seemed a bit like the Johnson paper. They seemed to be offended that something new was found that disagreed with their beliefs. Recall its science. That happens. It seemed biased and that they were reading into the paper things the authors were not even saying.

So I decided to run BLAST on some of the accession numbers in the Feria-Arroyo that they put in Table 1.

http://www.parasitesandvectors.com/cont ... 7/table/T1

I found it odd they had to trim the sequences in a custom fashion to force their custom section to either match or be close to the B31 used as a control.

So I ran the first for example, KJ826414 on NCBI Nucleotide:

http://www.ncbi.nlm.nih.gov/nuccore/KJ826414

Then cut out the FASTA sequence nucleotides and ran them on BLAST

TCGGAAAAAGCCAAGCTAGTAGAGTGACAATGCGCTAGGAGCCCAGGTGTCGCTCACACCGTTATGGTAC
ACCTAACATTTTCTTTTAATAAGAGAGTTTTTAAAACCAGTGTTATTTATGTAAGTTTAAGAGAAGTTTA
TGTATTAAATTATTGATATTAAATAGTTTTATTAGGCTTAGACTTAATTTTAGGTCATTTTGGGGGTTTA
GCTCAGTTGGCTAGAGCATCGGCTTTGCAAGCCGAGGGTCAAGGGTTCGAGTCCCTTAACCTCCATTGGG
CTTATGCCCTAAATTGTAATTAAGTATGTTTTTAAGTAACTTTGTTAAAGTAATTGTTGGAATGTGAAAC
ACAAGAAGTTAAAATTTCTGGGTTAAGTTGAGATCTGTTGATATTAAGAAAAATGTCTAGAAGCAAAAGC
AAGCTTTCGATAAAACCCGAAGTTGTTTCGCTAAAGTGCAAGGATTAAACAGGATTGTATTTTTCAGCAG
CCTATTTTATAAACGATCTGCATTTAGTAAATAGTTTTTAGTTAGGAAATAATGTAGATTACTAAGTGTG
ATGTCTGAGAGAAGGACAAGTATTGTAGCGAGCTTAAATCCTTATTATCGTTGCCAGTATTTAGTGGTAG
GGATTCGGATAAGATTGCCAGTTATAAGTTGGAGGAAGGCAAAGATTGCATTAAATCGTTATCGCTCTTA
TGTTTTAGGTTACAAGTTTGCAACAATAACTCAAAAAAGCCAAGCAAAATACCATAAAGCAGATTTCAGT
TTGGATTTGCCCGACACTCAATGGCATGAAGTTGTAATTGTTAGTAATCGTGTATACCTTAATATAGAAA
TTGAATAAATTTTTGTTTTTCTTATTAATTATAGCTTAAAACAGTATTGTCGTAATTAAAACAATGGAAT
ACATTGGGACCAGGATGAGTTGAACATCCGACTAGTTGTTATTACCCACAAAA

I just ran the whole 963 nucleotides to see what other samples of Borrelia in NCBI were a close match in order.

And low and behold, there were dozens of samples within a few nucleotides including:

B31 at 863/864 or 1 difference - Their big claim

But CA382, for example was 862/864 with only 2 differences as were many. This was submitted to NCBI by Barbour????

http://www.ncbi.nlm.nih.gov/nucleotide/ ... A91JBWV014

So it appears this stretch of Bb 16S-23S ribosomal RNA IGS varies very little across many Bb strains. So the small number of nucleotide variations just looks like the variations seen in dozens of Bb strains.

That means their claim it is B31 contamination is just plain biased and incomplete. It appears they had to cut sections on a custom basis to force them to look exactly like B31 when many many strains were also near identical to the whole sequence or the section that aligned and was in NCBI.

I ran through many of the sequences in Table 1 and the story was the same. Their claim that they were close to B31 is correct but they failed to mention that they are also just as close to many many other NCBI samples. So the claim of contamination has been used in a Disingenuous fashion.

Somehow it didn't surprise me that the angry Barbara Johnson would play games but this is scary. Science isn't a debate. You need to look at all sides of the situation. An analysis with integrity doesn't cut the sequences to force a match and then fail to acknowledge many Bb samples in NCBI for this section of the B 16S-23S ribosomal RNA IGS partial gene are JUST as SIMILAR!

I'm truly surprised these 3 would play this kind of game. The only explanation is they are just angry at all the criticism and use their power to mislead the scientific community.

WOW!

So is this just an oversight because this is consitent with their beliefs and they only looked at B31 and nothing else?

Or is it intentional?

Maybe they are even correct. But science isn't taking one side of a debate. Its looking at both point and counter-point and analyzing both. Its possible to trim these sequences and claim its B31 or any of another dozen strains. I find it odd they don't even mention the other possibilities.

[inmacdonald]

Mexican ticks vector both

Borrelia burgdorferi
And
Borrelia Garinii

Let us not lose track of
GARINII Borrelia strains in the Mexican Borreliosis Infectome

Respectfully

Alan B MacDonald MD , FCAP
March 3, 2015

[LHCTom]

Let us not lose track of
GARINII Borrelia strains in the Mexican Borreliosis Infectome

And your real point is?

[velvetmagnetta]

It took me a while, but once it dawned on me what LHCTom was getting at, my mouth involuntarily dropped open. Perhaps it is as Lorima once said, that some of us are too trusting of academics and researchers that our minds just cannot allow us to believe that these professionals, especially medical professionals whose sole purpose is to protect the public health, would behave in such a manner.

Did they think no one would notice that they selectively cut out portions of sequences in order to support a false allegation of contamination? This is misconduct.

Norris and Barbour, do you really think it wise to react in such a knee-jerk fashion and publicly trash someone's reputation? Why not contact the scientists themselves first if you need clarification on some of their experimental results? Instead, in a bid to save face for totally slacking off on the tick-collection/Borrelia-detection front, you shoot off a Revenge Letter wrought with false accusations and erroneous assumptions supported by cut-pasted-and-fudged sequencing magic tricks??

Shame on you. Well, you got caught and appropriately called out on it.

I hope you at least feel embarrassed by your behavior - and maybe start thinking about why you originally chose a career in medicine.

[LHCTom]

Norris and Barbour, do you really think it wise to react in such a knee-jerk fashion and publicly trash someone's reputation? Why not contact the scientists themselves first if you need clarification on some of their experimental results? Instead, in a bid to save face for totally slacking off on the tick-collection/Borrelia-detection front, you shoot off a Revenge Letter wrought with false accusations and erroneous assumptions supported by cut-pasted-and-fudged sequencing magic tricks??

Yes, I think Lyme research is the only field where this "hit and run" behavior is so extreme. I said the same thing when Johnson/Russel wrote their hit and run "assessment". Why didn't they call or email the other researchers and try and sort it out privately before using their repuations to attack researchers broadside. Its very rude. The only reason I can think of is EGO and they like to use their position as Lyme heavy hitters to attack peoples reputations.

Its obvious they didn't like these researchers finding a high tick infection rate in a location previously found to be low. I've spoken to one of the leading West Coast researchers at UCB about infection rates. We had my home tested and found a 3% rate within 50 feet of my home. He told me that hot spots are found all the time. You can test one area and find 3% and move a mile and its 25%. Just north of where I live in Mendocino, about 25 miles, he found a 40% infection rate. And just recently, he and researchers from both Stanford, UCB, Davis and the CA department of Public Health found B. miyamotoi infection rates higher than Bb in the Bay Area.

So different researchers go to different sites and find big differences all the time. They even find new species like B miyamotoi and B bissettii that had never before been seen. This happens all the time. So why the big reaction when the areas tested in Texas/Mexico were high. Its very weird because Fish was complaining that he had tried to get NIH funding to look for miyamtoi for 5 years and was turned down. Now he is angry that others have made the discoveries and he didn't get all the credit.

You just cannot trust them. There is too much EGO and politics and science is getting the back seat.

[hv808ct]

Re: Mexico Not Taking It Lying Down!
Post by LHCTom » Tue 3 Mar 2015 4:27

I'm not a conspiracy theory type but….

I'm truly surprised these 3 would play this kind of game. The only explanation is they are just angry at all the criticism and use their power to mislead the scientific community.

Or is it intentional?

Yes, I think Lyme research is the only field where this "hit and run" behavior is so extreme. I said the same thing when Johnson/Russel wrote their hit and run "assessment". Why didn't they call or email the other researchers and try and sort it out privately before using their repuations to attack researchers broadside. Its very rude. The only reason I can think of is EGO and they like to use their position as Lyme heavy hitters to attack peoples reputations.

So why the big reaction when the areas tested in Texas/Mexico were high. Its very weird because Fish was complaining that he had tried to get NIH funding to look for miyamtoi for 5 years and was turned down. Now he is angry that others have made the discoveries and he didn't get all the credit.*

You just cannot trust them. There is too much EGO and politics and science is getting the back seat.

Really? You’re not a conspiracy theory type?

It could be that Sapi et al. are just incompetent hacks with an agenda they make no pains to hide. And in the case of the Texas border epi issues, it may be just a matter of technical emphasis that further publications likely will clear up one way or the other, and as I noted earlier:

“Norris et al. suggest that the Feria-Arroyo et al. publication is advocating a high LD risk in Texas and Mexico but this cannot be further from the truth. Unlike publications that have aimed to create disease risk maps based on questing infected nymphs the Feria-Arroyo et al. presents a habitat suitability model for the presence of the vector in the studied area, and no predictions are made in regards to the density and prevalence of infected ticks. We agree with Norris et al. that it is unfortunate that the “Feria-Arroyo et al. has been publicised as an indication of a significant Lyme disease risk in Texas” but misinterpretations of that paper in media outlets are not the responsibility of the authors.”

Perhaps you should take your own advice and “call or email the other researchers and try and sort it out privately before” attacking them. (It’s very rude.) Or just do what most people do: take your analysis and submit it to the journal editor. If it has merit it will be published. This isn’t the place to do it--This is a small forum for amateurs and people who may or may not have LD, with the occasional comment from people in the LD research community.

*Really? He’s done 13 papers on this bug since 2001 (http://www.ncbi.nlm.nih.gov/pubmed/?ter ... +miyamotoi) and has a NIH grant with Peter Krause (See: http://projectreporter.nih.gov/reporter.cfm). I’m pretty sure Durland is not lying awake at night seething with angry because other people are working on the same bug.

[ChronicLyme19]

I'm not going to take guesses at why this happened, but I'd just like to say thank you to LHCTom for pointing out other possibilities in the science once again.