…try plugging that sequence into a BLAST nucleotide search—with or without the Borrelia taxid—and see how many sequence returns you get.
I think maybe its a typo....
TGGGAAGTTTCTGGTAAGATTAA
23 letters is in this post
Which has no perfect matches 19/19 is the best for
Elaeophora elaphi genome assembly E_elaphi ,scaffold EEL_scaffold0000153
but in the other post we have
TGGGAGTTTCTGGTAAGATTAA
22 letters
returns
only Borrelia DNA flagellin protein with a perfect 22 letter match
Except it also shows some transfection results from Homo Sapien brains where Bb was found in brain hippocampus from 2005 by MacDonald,A.B., Li,L. and Ferrer,L.
No other petrfect matches as suggested.
Same other post shows B miyamtoi as:
TCAGCCATAAATGCTTCCAGAAATAATGGC
Which is also Borrelia miyamotoi DNA flagellin protein with a perfect 29 letter match
Here is the BLAST listing showing the 100% matches for all letters for:
TCAGCCATAAATGCTTCCAGAAATAATGGC
The greater the ignorance, the greater the dogmatism.
Attributed to William Osler, 1902