Page 2 of 2

Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID

Posted: Tue 3 Mar 2015 18:22
by hv808ct
Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID
Post by inmacdonald » Tue 3 Mar 2015 16:54

FOR THOSE WITH AN INTEREST IN THE DIAGNOSTIC POWER OF
FISH METHOD (Fluorescent In Situ Dna/mRNA Hybridization)
…try plugging that sequence into a BLAST nucleotide search—with or without the Borrelia taxid—and see how many sequence returns you get.

http://blast.ncbi.nlm.nih.gov/blast/Bla ... ialGenomes

Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID

Posted: Tue 3 Mar 2015 19:33
by LHCTom
…try plugging that sequence into a BLAST nucleotide search—with or without the Borrelia taxid—and see how many sequence returns you get.
I think maybe its a typo....
TGGGAAGTTTCTGGTAAGATTAA
23 letters is in this post

Which has no perfect matches 19/19 is the best for

Elaeophora elaphi genome assembly E_elaphi ,scaffold EEL_scaffold0000153

but in the other post we have
TGGGAGTTTCTGGTAAGATTAA
22 letters

returns only Borrelia DNA flagellin protein with a perfect 22 letter match

Except it also shows some transfection results from Homo Sapien brains where Bb was found in brain hippocampus from 2005 by MacDonald,A.B., Li,L. and Ferrer,L.

No other petrfect matches as suggested.

Same other post shows B miyamtoi as:
TCAGCCATAAATGCTTCCAGAAATAATGGC
Which is also Borrelia miyamotoi DNA flagellin protein with a perfect 29 letter match

Here is the BLAST listing showing the 100% matches for all letters for:
TCAGCCATAAATGCTTCCAGAAATAATGGC