Pathogenic Borrelia Genetic Chimera by FISH imaging of Alzheimer'sDisease Brain

Medical topics with questions, information and discussion related to Lyme disease and other tick-borne diseases.
Post Reply
User avatar
inmacdonald
Posts: 977
Joined: Fri 13 Jan 2012 22:32

Pathogenic Borrelia Genetic Chimera by FISH imaging of Alzheimer'sDisease Brain

Post by inmacdonald » Sun 1 Mar 2015 19:25

A Chimera, genetic type, of borrelia ( Burgdorferi-FlaB and Miyamotoi-Flab) was discovered
in FISH studies of an Autopsy human Brain., from a European who had a neuropathology Diagnosis of Alzheimer's Disease Braak Stage VI
by Neuropathological Specialist Examination. Because the patient was ,during his lifetime ,documented to be posiitve
for Multiple antibodies to Lyme Borreliosis, in ELISA and in Western Blots, the family requested that a
second Borrelia focused Autopsy, using Borrelia Specific DNA Probes be initiated.
This was done using Moleecular Beacon type DNA Probes for burgdorferi Borrelia and for Miyamotoi borrelia,
with positive DNA Hybridizations documented with each of the probes in single DNA probe studies.
An additional examination, utilizing thesimultaneous appication of BOTH BorreliaSpecies DNA probes on the same
slide( DNA probe-Miyamotoi- Flagellin,and DNAprobe Burgdorferi Flagelllin B) produced image evidence of
a UNIQUE population of CHIMERiC Pthogenic borrelia inside of the areas of Alzheimer's Brain Injury.

Naturally occurring PATHOGENIC Genetic Chimera of Borrelia of any species have never before been discovered.

Molecular Beacon DNA probes , previously validated for Specificity and Efficacy, carried Fluorochromes as follows:
Miyamotoi-FlaB ( 30 mer length)-Cy5 [Red] and Burgdorferi- FlaB (22 mer length) -FITC [Green}

Individual FISH interrogations Confirmed that the Molecular Beacon DNA probes hybridized to
two Borrelia spirochetes in a microscopic field of view- Using single Molecular Beacon DNA probes in a FISH Method.
The product of the FISH Hybridization was Green fluorescence with the Burgdorferi FlaB Probe and
Red fluorescence with the Miyamotoi Fla B DNA probe.

Simultaneous Multicolor FISH was completed using equimolar amounts of The FlaB-Burgdorferi and FlaB-Miyamotoi probes in a single hybridization. Products of Multicolor probe hybridization were examined as follows:
1.--Single monochrome excitation illumination ( LED with 490 nm wavelength) --Result = Green fluorescence
2,--Single Monochrome Excitation illumination ( LED with 650 nm illumination( --Result = Red fluorescence

Double simultaneous excitation of the identical field of view for 1. AND 2., ABOVE
---DOUBLE simultaneous illumination with LED 490 nm (green) and LED 650nm( red)
The two spirochetes issued a Yellow Fluorescent signal.
The Yellow signal is the Summation of Wavelength fluorescence from the 490 nm light and from the 650 nm light sources.

These Summation Multicolor FISH Probe Hybridizations : Provide Data a proof positive of the Existence of a Genetic Chimera of Borrelia,
which is pathogenic in Human autopsy brain.

Similar Detections of Chimera microbes have utilized two color Fluorescence post DNa probes hybridization
in microbes in Sewage Sludge.( See Graphic for citation.)
The difference in methodology for FISH detection of Chimeras in this report is that
SUMMATION of Colors of fluorescence was utilized by Snaidr,J, er at; and in a Sewage Sludge microbe chimera study
SUBTRACTION of Colors of fluorescence was utilized; Chimeras in the Sewage Chimera Study were Either
Pure Red or Pure Green , and the native parent microbes were Fluorescing yellow because the parent microbes :
FISH hybridized with probes carrying BOTH CHROMOGENS Cy5 at 3' and FITC at 5" ends of the parental wild type produced a yellow color.
Loss of parental nucleotide sequences at either the 3' or 5' ends of the genome- via Chimera integration/replacement with nucleotides from an unrelated microbe species)
produced either Red fluorescence
or Green fluorescence,
depending on the anatomic site Chimeric integration of other species nucleotide sequences in the Chimera
( 3' end or 5' ends) of the native parental wild type chromosome.

CHIMERIC spirochetes (many variants) have been reported in Termite Gut.

Chimeric Borrelia spirochetes now provide , beyond mere mutation, or deletion or transformation,
yet another biology for Genetic Diversity in Pathogenic borrelia microbes.

_____________________________________________________________________
jpg Chimera Borrelia spirochetes in Alzheimer's.jpg
jpg Chimera Borrelia spirochetes in Alzheimer's.jpg (152.25 KiB) Viewed 716 times
___________________________________________________________________________
Reference: Snaidr, J, Amann, R., Huber, W., and Schieffer,K.H., 1997,
"Phylogenetic Analysis ain In Situ Identification of bacteria in Activated Sewage Sludge", 1997, 63(7) 2884-2896.
Primer Sequences for Borrelia Genetic Chimera Study reported here:
Burgdorferi borrelia FlaB (22mer) TGGGAGTTTCTGGTAAGATTAA
Miyamotoi Borrelia FlaB (30 mer) tcagccataaatgcttccagaaataatggc

Respectfully Submitted
Alan B. MacDonald, MD, Fellow, College of American Pathologists
March 1, 2015

Post Reply