DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID

General or non-medical topics with information and discussion related to Lyme disease and other tick-borne diseases.
hv808ct
Posts: 256
Joined: Wed 30 Jul 2008 4:11

Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID

Post by hv808ct » Tue 3 Mar 2015 18:22

Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID
Post by inmacdonald » Tue 3 Mar 2015 16:54

FOR THOSE WITH AN INTEREST IN THE DIAGNOSTIC POWER OF
FISH METHOD (Fluorescent In Situ Dna/mRNA Hybridization)
…try plugging that sequence into a BLAST nucleotide search—with or without the Borrelia taxid—and see how many sequence returns you get.

http://blast.ncbi.nlm.nih.gov/blast/Bla ... ialGenomes

User avatar
LHCTom
Posts: 341
Joined: Mon 22 Oct 2012 4:18

Re: DNA hybridization BY FISH FINDS BORRELIA IN SPINAL FLUID

Post by LHCTom » Tue 3 Mar 2015 19:33

…try plugging that sequence into a BLAST nucleotide search—with or without the Borrelia taxid—and see how many sequence returns you get.
I think maybe its a typo....
TGGGAAGTTTCTGGTAAGATTAA
23 letters is in this post

Which has no perfect matches 19/19 is the best for

Elaeophora elaphi genome assembly E_elaphi ,scaffold EEL_scaffold0000153

but in the other post we have
TGGGAGTTTCTGGTAAGATTAA
22 letters

returns only Borrelia DNA flagellin protein with a perfect 22 letter match

Except it also shows some transfection results from Homo Sapien brains where Bb was found in brain hippocampus from 2005 by MacDonald,A.B., Li,L. and Ferrer,L.

No other petrfect matches as suggested.

Same other post shows B miyamtoi as:
TCAGCCATAAATGCTTCCAGAAATAATGGC
Which is also Borrelia miyamotoi DNA flagellin protein with a perfect 29 letter match

Here is the BLAST listing showing the 100% matches for all letters for:
TCAGCCATAAATGCTTCCAGAAATAATGGC
Attachments
BLAST miyamotoi.JPG
BLAST miyamotoi.JPG (62.86 KiB) Viewed 788 times
The greater the ignorance, the greater the dogmatism.

Attributed to William Osler, 1902

Post Reply